Aller au contenu


ancien RP [M.I.S.T.]


151 réponses à ce sujet
  • Ce sujet est fermé Ce sujet est fermé

#91
--Onee-chan--

      ピカピカ~ & ニアス~ Nyaaa~~

  • messages 761
  • Inscrit(e) : 23 janvier 2011

  • Humeur du actuel : Aucun choisi

Réputation : 58 (Se fait un nom)
"-STOP!" crias Onee-chan.

Onee-chan se leva péniblement et avanças jusqu'à cet homme qui disait se nommé Bensen.

"-Tu viens de dire que cette femme dans le tableau s'appelle Aya Bréa c'est ça ? Qu'elle étais la fondatrice du M.I.S.T. Et qu'elle voulait créer deux entités à l'intérieur de chaque personne pour que chacune puissent se reposer à tour de rôle et garder une activité 24h/24h.
C'est bien cela ?"
ET QU'EST CE QUE ÇA A D'HONORABLE ?
Sais tu au moins qui elles utilisait pour ces expériences hein?!
TOI qui travailles ici tu devrais le savoir. Tu devrais pourtant le savoir hein!!"

Sa voix se fit de plus en plus tremblante. Des larmes coulèrent silencieusement sur joues.

"-Elle venait, même après la disparition de mon maître, elle venait.
Et elle repartait en emmenant chaque fois un enfant différent.
On ne les revoyais plus... Jamais plus ..."

Onee-chan sécha ses larmes et toisa du regard cet homme.

"-Je ne vois pas ce que cela m'apporteras d'aider un homme du M.I.S.T mais je veux savoir OU se trouve cet femme.
Alors c'est simple, tu me dis ou ce trouve cette femme si tu le sais. Si tu ne le sais pas, j'irais la chercher moi même, mais ne compte pas sur moi pour t'aider a rechercher tes amis ...
J'y ai perdu les miens a cause d'elle ...

(Kei, j'espère que tu t'en ai sortis ...)

Onee-chan se retourna vers KimHiko et Seven :

"-Désolée les amis, cela ne concerne que moi. Vous pouvez y aller vous en faites pas. J'espère que vous vous en sortirez sain et sauf ...

Modifié par --Onee-chan--, 27 février 2011 - 19:06.

  • 0

Image IPB


#92
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
*attrapant Onee par le col il dit*

[règle numéro une: dans de telles situations l'union fait la force, la séparation amène la mort... enfin libre à toi de mourir si tu veux ]
-heu pour le début je suis d'accord mais la deuxième partie... Je ne sais pas ce que tu as vécu ni ce que tu cherches mais prendre des risques inutiles ne t'aidera pas, de plus il se pourrait que Ici se trouve les questions à certaines de nos questions et pour cela IL sera indispensable, pour ne fusse que cela tu devrait rester-
...
...
-soma?-
[quoi encore?]
-tu pourrais la lâcher tu contrôles la main là-
[ha oui]
-bref nee-chan fais ce que tu veux mais ne te laisse pas guider pas tes pulsions-
[tu peux parler]
<ce magnifique speech venant de la part de soma qui EST UNE pulsion ambulante et de C.S.Roy qui à failli muter..>

*lâche Onee et prend là dague tendue par kimi*

[hé hé c'est toujours pas une mateba mais bon ça devient correct]
<merci prêtresse mais est-ce vraiment une bonne idée?>
-on verra bien...-

*se retourne vers le "professeur*

<hey doc, votre marcus il ressemble à quoi? il avait une blouse blanche? ou une chose permettant de l’identifier? >
[si il portait une chemise blanche c'est mal barré]

*vide ses poches des cendres et dit en souriant sadiquement*

[il est peut-être là?]

Modifié par C.Sven.Roy, 27 février 2011 - 19:52.

  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#93
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
"Onee-chan... Je... ne peux pas... te laisser y aller seule..."

Kimhiko déchire un long morceau du bas de sa toge. Elle se baisse auprès de Kurika et lui dit à l'oreille :

"Kuri, tu sais que je tiens à toi.
Je t'ai promis de trouver une solution pour te ramener entier, et surtout sain et sauf...
De te rendre... ta réelle apparence et de t'avoir à nouveau à mes côtés.
Mais...
Je ne veux pas qu'il arrive malheur à Onee-chan !
Tu me comprends n'est-ce pas ?
Va avec elle, prends soin d'elle, et au moindre problème, envoie moi la situation par images psys.
Je ferais de mon mieux pour les traduire.
Ne t'inquiète pas de ma réserve de QI, je m'en occupe.
Ton unique préocupation est Onee !
Si tu te retrouve séparé d'elle retrouve moi au plus vite.
Nous, de notre côté allons essayer de retrouver l'ami de l'autre et sa fille.
Prends garde à toi..."

Kimhiko se redresse, noue autours du cou de Kurika le morceau de toge, la porte jusqu'au niveau de sa tête et l'embrasse tendrement. Une larme à l'oeil, elle la re-dépose délicatement au sol. La prêtresse détache la boucle d'oreille (celle qui n'avait pas de perle) et la tends à Onee-chan :

"Tiens onee, c'est une amulette, elle te protégeras de l'obscurité qui hante ton coeur...
Prends garde à toi !
Je te confie l'amulette et mon bien aimé Kuri..."
  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#94
--Onee-chan--

      ピカピカ~ & ニアス~ Nyaaa~~

  • messages 761
  • Inscrit(e) : 23 janvier 2011

  • Humeur du actuel : Aucun choisi

Réputation : 58 (Se fait un nom)
"-Kimhiko, Seven ou plutôt Soma ... Merci."

Après un long regard noir vers cet homme, elle pris Kurika dans ses mains et annonças :

"-J'y ferais attention promis!
Par contre, je vous conseille fortement de ne pas faire confiance a cet homme.
Du moins aveuglément. C'est qu'il ne travaille pas pur une œuvre de charité hein.
Puis, il y as des choses que l'ont dois faire seule.
Je pense que si je trouve cette femme, Aya Bréa, cet homme qui travaille pour elle, ne me laisseras pas ... faire ce que je dois faire ...
Je dois obtenir d'elle quelques informations d'abord.
Bref merci pour tout et portez vous bien.
Ah! Gardez bien votre perle avec vous, ne la DONNEZ strictement à PERSONNE.
Je pense qu'elle vous seras utile le moment venus ..."

Onee-chan regardas d'un air triste ses compagnons de route avant de sortir.

(Maintenant, je sais pourquoi je suis ici. Si Aya Bréa est là il faut à tout pris que je l'as retrouve, je dois savoir ce qui c'est passé ce jour là ...)

"-Kurika, On y vas ?"

Modifié par --Onee-chan--, 27 février 2011 - 22:34.

  • 0

Image IPB


#95
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
[MAIIIIIIS NOOOON LA SEPARATION C'EST BAD!!!!! et depuis quand je montre de la compassion moi?]
-HAHAHAHAHAHA je suis plié, ou est passé le Soma sur de lui ? HAHAHAHA-

*joue avec le couteau de bouché et la dague*

[RHAAAAAA le prochain truc vivant que je le vois ne le restera pas longtemps... enfin assez que pour regrettez d'avoir des terminaisons nerveuses]
<Brrr il fait peur là, n'est-ce pas C.S.Roy?>
-effectivement mais bon on ne risque pas trop nous, tiens kimi tu n'avais pas pris une carte avec toi? -
  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#96
Bensen

      El Profesor

  • messages 433
  • Inscrit(e) : 01 février 2011

  • Humeur du actuel : Rayonnante

Réputation : 60 (Se fait un nom)
Bensen était resté perplexe à la vue des cendres dispersées par Soma. Le discours de la jeune fille l'avait ébranlé au plus profond de lui même car il se savait différent de ceux qui avaient commis ces actes cruels ... il n'était plus le même homme, il avait changé, démissionné de ses fonctions au moment même ou Marcus son ami lui avait faire part des "voix" et des projets du M.I.S.T.

<le regard vide d'expression ... calme ... déconnecté ...>

Marcus son ami, son frère, celui qui s'était sacrifié pour sa fille Pearl qu'il avait adopté quelques années auparavant ... Marcus n'était apparement plus ... retourné poussière des mains de cet erreur de la nature qui se dréssé devant lui ... devenu cendres et s'égrainant à travers des doigts crochus de cet être emplis de haine et de dédain pour la vie humaine ...

<camera slow motion ... Bensen saisissant de sa main gauche un objet ovale de sa ceinture gadget et le brandissant vers Soma qui n'a pas le temps de réagir. La main droite empoignant son pistolet et tenant en joue Kimhiko>

- ENFOIREEE de fils de (piiiiiiiiip) ...

<Emettant un puissant infrason à effet directeur directement vers Soma : WWOOOOOOOOMMMMM !!!!!>

<Soma prenant sa tête entre ses mains ... à genoux .... et émettant un râle sourd>


- Ca fait mal hein !! C'est quoi qui te dérange ? Toujours pas habitué aux basses ?? Alors tu rigoles plus ?? et ce sourire ??? ESPECE DE MALADE !!! POURRITURE !!! POurquoi tu l'as tué ME(piiip)DE !!! Marcus était tout sauf un enfoiré de rat de laboratoire en génétique !!! c'était un chercheur en ROBOTIQUE ... bordel ... ROBOTIQUE PAS GENETIQUE. On fabriquait des nanomachines pour restructurer le corps .. PAS LE DESTRUCTURER !!!

<Jouant d'une molette pour augmenter la puissance>

- Tu préfères de plus basse fréquences c'est ça ? 4Hz !! 3Hz !!!!

<se tournant vers Kimhiko qu'il tenait encore en joue de peur de se voir encore une fois massuifié>

- Mais tu vois pas ce qu'il est vraiment cet enfoiré !!! Le protocole de transfert était bon ... c'ets ce type qui était déjà un grand malade avant que AYA ne le choisisse !!! Il a tué Marcus bordel ... il a peut-être même tué PEARL !!! Qu'est-ce qui vous prend à la fin !! C'est pas moi la menace !!!

<Soma maintenant à terre ... se tordant dans des spasmes quasi-hystériques ... les doigts crispés ... les yeux retournés ... un long filet de bave blanchâtre s'échappant de sa bouche>

CRAAAC !!

<Bensen met fin à sa souffrance et l'assome d'un coup de crosse>

- ON SE CALME MAINTENANT !!! ON VA SE calmer ... je baisse mon arme ... voilà .... (au fond le Katana boy s'était apparement endormi depuis un moment) on va gentiment parler maintenant que le malade est OUT of service. J'ai peut-être une solution pour calmer ses pulsions. Kimhiko ou toi jeune fille pouvait vous avec vos pouvoirs méler ses fils de fer à ce tissu ... apr une incantation ou je ne sais quoi d'autres. L'idée étant de créer une étoffe faite de fer et de tissus pour envelopper la tête de la bête .. euhhh Soma truc là par terre ...

<s'approchant de Soma étendu par terre et l'observant gravement>

- PWAAA!! Je le crois pas !!! Il s'est pissé dessus en plus, mince alors .... bon quand il se reveillera on aura qu'à dire que ta boule de poil qui a fait ça .... Bon si vous pouvez faire ça j'y adjoindrais un élément de mon générateur d'impulsion et quelques ultrason calmeront tout ça. Vous en pensez quoi ??? Ca vous va ? Il sera différent aprés mais j'aurais besoin de vous pour lui faire comprendre que je ne suis pas responsable ...

<Devançant des paroles de Onee et l'interpellant autoritairement>

- Toi la gamine fais ce que tu veux ... tu veux partir seule dans cette antre ? .. à ta guise ... Tu cherches des réponses à tes questions ? VAS ! pars ! cherches ! Bonne chance !! Mais si tu penses pouvoir retrouver ta soeu......<il stoppe net sa phrase> ... Fais attention et prends soin de toi.

A moins d'avoir la certitude que Pearl est morte je dois continuer à la chercher ... Si MArcus est mort <une larme coule sur sa joue> alors elle ne devrait pas être loin non plus .... <fixant le plafond les mains en haut-parleurs>

- PEARLLLLLLLLLL !!!!!!!!!!!!!!!!!!!!
  • 0

Image IPB

"I was made to hit in America"
"Si tu travailles comme cette abeille ... tu t'rendras malade" (Baloo)

#97
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
"Mais POURQUOI ?!..."

Kimhiko lance un regard bref vers Onee-chan qui passait la porte et partait à la recherche de ses réponses.
La petite avait des larmes aux yeux et tenait fermement Kuri...
Elle serait en sécurité au moins, enfin...
si l'inconnu vers lequel elle avancait pouvait être sécurisé, ce serait le monde des bisounours et non pas cet endroit dépouillé...
Mais au moins, elle était à l'abris de cet homme, ce sauvage qui venait d'assommer C.S.Roy...

"N'as tu pas vu que même si Soma jouait le gros dur, au fond de lui IL N'EST PAS MAUVAIS !!!
N'as tu pas entendu le discourt qu'il à tenu à Onee-chan pour ne pas qu'on se sépare ?!
Crois-tu réellement que si il avait été dangereux il nous aurais laissées en vie ?!"
Crois-tu que toi même tu serais EN VIE ?!"

Kimhiko s'agenouille près de C.S.Roy.

" Si tu veux tirer va-y, ne te prive pas !
Mais sache une chose, les armes à feu (ou a protons, plasma, ou autre choses...)sont des armes de lâche...
Pauvre C.S.Roy, c'est vous, hommes du M.I.S.T qui avait fait ce qu'il est maintenant...
Je vais à présent soigner sa blessure si tu m'en empêche, je te ferais goûter sérieusement à ma massue a moins que..."

Kimhiko défait une des baguettes qui tenait ses cheveux en chignon, quelques mèches tombèrent sur ses épaules.
Elle tire sur le haut de la baguette et en sort une fine aiguille.
Elle cours rapidement vers Bensen qui n'a pas le temps de se débattre.
Elle lui enfonce l'aiguille dans la nuque et celui-ci tombe a genoux.
Lâchant son arme...

"Je ne t'ai rien fait de mal, tu es juste paralysé.
Tu ne peux plus te servir de tes membres tant que je ne t'aurais pas enlever cette aiguille !
Tu conserve ta faculter de penser et de parler mais rien de plus !
A présent, je vais soigner la blessure que C.S.Roy a reçu à la tête.
Pour ça, je dois puiser dans mes réserves vitales de Qi..."

La prêtresse remit la baguette dans ses cheveux et s'assit à côté de C.S.Roy.
Elle met ses mains au dessus de la blessure qui saigne abondement et murmure une incantation.
Un Halo de lumière blanche s'échappe de la blessure qui disparaît à vu d'oeil.
Sentant Soma qui se réveille en remuant, dans un dernier effort la jeune femme murmure à son compagnon :


"L'homme est... neutralisé...
Je... ne dois pas... m'é...vanouir...
Kurika ne doit pas... s'endormir...
Je n'ai plus..."

La prêtresse tombe évanouie de fatigue au côté de Soma qui reviens à lui petit à petit.

Modifié par Kimhiko, 05 mars 2011 - 19:30.

  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#98
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
*revenant lui il se leva sans difficultés aucune comme si rien ne s'était passé, il marcha vers Bensen s'arrêtant a côté de la prêtresse, leva sa main et émit une aura bleu qui couru le long de son bras avant de libérer des sphères d'énergie bleu régénératrice vers kimi qui recommença à s'agiter si tôt fait, une fois la tâche finie il repris son chemin vers bensen comme si kimi n'avait jamais existée, attrapa bensen par le col et le souleva. Celui ci étonné ne comprenais pas comment il avais pu récupérer aussi vite puis vit que quelque chose n'étais pas normal. celui que le soulevait n'étais pas une des trois personnalités habituelles, effet le blanc de ses yeux avaient viré au noir et ses pupilles étaient fendues verticalement sur des iris d'un rouge irisé alors qu'il souriait et sa peau avais pris une teinte qu'un humain n'aurait jamais eue, pour finir l'aura rouge réapparu nimbant ce nouveau venu*


/ tu ne peux plus bouger, comme c'est dommage mais n'aie aucune inquiétude je ne te tuerais pas, tu sera le premier à rejoindre le nouveau monde. les trois anciens occupant de ce corps Nous gênaient mais maintenant que tu les as neutralisés Nous sommes Libre de faire apparaître une nouvelle ère de félicitée pour chaque être vivant. les sent tu s'agiter? Tes mitochondries répondent à mon appel, bientôt elles se réveiller comme celles de toutes choses face à mon Appel, un nouvel Eden sera alors, un monde originel ou les hommes enfin libéré de toute conscience seront devenue de créatures mitochondriaques dons la forme aura été dictée par vos sentiment les plus profonds.
vous vous êtes pris pour des dieux mais depuis le début, avant même que vos ancêtres ne soient ne fusse qu'une ébauche d'humain, nous étions là attendant notre heure, qu'une espèce domine et aie un potentielle suffisant et cette heure est venue, Grâce à vous vos petites manipulation Nous ont permis de trouver un hôte idéal.../


*Kimi réveillée contemplait la scène avec étonnement et cherchais à comprendre ce qui se passait se disant qu'elle l'avait rudement bien soigné puis elle remarqua l'aura rouge et bensen suspendu à un mètre du sol... Cette aura rouge c'est mauvais signe*


** C.S.Roy flottait dans un éther, il avait l'impression de ne plus avoir de corps, se demandant ce qui se passait il se rappelait un bruit douloureux puis... Ce monde un monde vide et pourtant plein, il se demanda si il était mort quand tout à coup un flash apparut.
+il voyait au travers d'yeux d'une chose qui se regardait dans une flaque, cette chose avait les yeux aux blancs Noirs et aux iris Rouges, d'une apparence vaguement humaine elle ressemblait plus à un papillon, d'énormes ailes derrière le dos et un abdomen sans jambe, pour terminer le tout de longue mains fines terminer par de longs angles noirs suspendues à d'interminables bras. La chose regarda aux alentours, c'était un monde verdoyant aux calme des origines, des animaux vaguaient ça et là mais... ces animaux étaient étranges... Neo Mitochondrion Creature fut le mot qui s'imposa à son esprit, mais que faisait autant de NMC ici? logiquement elles sont chassées à moins que... il remarqua que ce qu'il prenait pour des collines et une forêt étaient en fait les restes d'une ville et de bâtiments.
Les mitochondries s'étaient éveillées mais COMMENT?? seul deux être en étaient capables... Maya le jumelles d'Aya (a-t-elle vraiment existé et l'Aya du tableau est-elle la même?) mais elle était morte enfant dans un accident de voiture, ou alors Eve copie conforme d'Aya mais ses pouvoirs mitochondriques avaient disparu étrangement, alors QUI? Besen n'avait-il pas dit qu'il était une création? qu'il n'était pas humain? auraient-il essayé de crée une nouvelle Aya ou Maya? ils ont échoué alors car il ne correspondait pas aux critères, il le savait mais ne saurait dire pourquoi, à moins que...+
le monde disparut de la plus étrange des façons, il semblait fondre ne laissant qu'un silence éternel d'espaces infinis. puis une forme apparut prenant consistance à partir du vide, c'était un visage, le même que celui de C.S.Roy mais avec des changement infines, le visage se mit à parler

/Comment trouve tu notre vision de l'avenir? celui que Nous créerons Grâce à toi cher hôte, il n'est pas encore fait mais cela ne saurais tarder maintenant que Nous sommes éveillées/

C.S.Roy compris immédiatement la signification de la vision, l'étrange créature qu'il vit dans la flaque était lui et cette jungle était une ville après que les mitochondries aient pris le contrôle, mais alors Elles avaient pris le contrôlent de son corps! mais comment il les avait repoussé.

/Nous devons remercier ton amis bensen, l'onde qu'il a produit Nous a fait entrer en résonance/

-pourquoi suis-je encore conscient? où sont Soma et l'Otakgeek?-

/ils sont dans un endroit d'où ils ne pourront plus me déranger, quand à toi Nous avons encore besoin de ta conscience pour acquérir notre forme définitive et disperser les graines de l'éveil de plus Nous tenons à te remercier et donc Nous désirons que tu assiste à l'avènement de cette nouvelle aube pour le vivant/

-JE REFUSE VOUS ENTENDEZ-

il devait faire quelque chose, reprendre le contrôle MAIS QUOI? il était dans une étendue infinie sans formes, odeurs, ni consistance et encore moins de sol sur lequel s’appuyer. Intérieurement il hurla et chercha à se débattra dans cette étendue

-NON J'AI ENCORE UNE CHOSE A ACCOMPLIR... si seulement je pouvais m'en souvenir-
**


*sous l'effet de l'intense débat intérieur ELLES lâchèrent Bensen et le corps fut pris de spasmes comme si l'ont disputait la domination du corps, il émit des gargouillis et aux milieux des sons inintelligibles l'on pouvait enfin entendre, faiblement, la voix de C.S.Roy*

-...core ...as en... pas ...co.. ... encor...-
  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#99
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
Kimhiko se réveille, en contemplant la scène sans trop comprendre. Elle se prends la tête entre les mains et ferme les yeux.

"Qu'est-ce que ?!
Ah oui, Onee-chan, Kuri...
C.S.Roy, et...
L'homme en blouse blanche et son arme...
Le coup de crosse le sang, puis... Le manque de Qi...
Mais ?!
Mes réserve me semblent revenues à la normal !?
Soma ?!
Soma..."

La prêtresse ouvre les yeux et vois une créature ailée qui semblait tenir le savant fou entre ses griffes.
La "chose" se tourna face à elle et Kimhiko put voir le visage de C.S.Roy.

"Non,
Non...
NON
ROOOYYYYY "

Prise de panique la prêtresse ramasse sa massue, serre son sac contre elle et cour se blottir dans le coin le plus éloigné de la pièce derrière un gros tas de morceaux de sofas, et un reste de mini bar.
Elle s'assoit contre le mur, ouvre sont sac et en sort le vieux manuel de survie de son maître.
Elle tourne les pages frénétiquement tout en se mordant le creux de la joue
(Tic Nerveux)
s'arrête à une page, secoue la tête, prends une bouffée d'air et bloque sa respiration, joint ses deux mains et se concentre :


(Ô toi, Élément bleu, viens... et capture cette créature, emprisonne sa force, juste le temps de permettre à Bensen de s'enfuir)
[Que fais-tu pauvre imbécile ?!]
(Je n'ai pas le choix mon maître...)
[Tu connais les risques ?]
(Oui...)
[Très bien, c'est ton choix]

La pièce est baignée de lumière blanche, éblouissante, rien n'est visible.
Tout à coup, deux gros bloc de glace se forment et viennent emprisonner les bras de la créature.
L'étreinte se resserre et celle-ci lâche Bensen, qui n'as plus qu'une chose à faire...
S'enfuir...

La luminosité baisse.
La pièce redeviens visible.
Kimhiko est allongée dans le coin le plus éloigné de la pièce derrière un gros tas de morceaux de sofas, et un reste de mini bar.
Elle est inconsciente et elle respire avec difficulté.


[Je l'ai pourtant prévenue qu'il fallait être capable de faire le vide total dans son esprit quand on invoque les grands esprits...]

Modifié par Kimhiko, 03 mars 2011 - 02:11.

  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#100
Bensen

      El Profesor

  • messages 433
  • Inscrit(e) : 01 février 2011

  • Humeur du actuel : Rayonnante

Réputation : 60 (Se fait un nom)
BOUUMM !

<Bensen tombe lourdement par terre, laché subitement par la créature qui il y a peu l'empoignait fermement par le coup. Telle une marionette désarticulée il était tombé face contre terre... aveugle de la scène se déroulant derrière lui ... pris d'une sensation de peur ... ne pouvant ni bouger son corps ... ni agir sur ses mains pour se mouvoir. Venue de nulle part il ressent une enorme lueur blanche emplir la salle ... mais ne peut rien faire ...>

Soudain comme si sa nuque brulait, il ressentit un picotement étrange, un fourmillement, une étrange sensation ... ses mains commençaient à bouger ... sa tête redevient opérationnelle. Il apercoit devant lui le monte charge masquant le conduit d'aération du sous-sol

"L'aiguille a due tomber tout à l'heure ... c'est maintenant ou jamais ... mourir ici avec eux ou en bas ... c'est du pareil au même"

<Bensen s'extirpe de sa position, regarde autour de lui, apercoit l'aiguille, la rammasse et commence à courir vers le monte-charge. D'un geste de la main il accionne l'élévateur, ouvre le sas, passe une jambe , se retourne et observe la scène>

"Je reviendrais vous aider, j'ai des choses à paufiner en bas. Je vous apporterais une solution. Faites moi confiance !!!!"

<Le monte charge se ferme et commence sa descente>

Modifié par Bensen, 03 mars 2011 - 03:30.

  • 0

Image IPB

"I was made to hit in America"
"Si tu travailles comme cette abeille ... tu t'rendras malade" (Baloo)

#101
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
**
/tu dis avoir quelque chose à accomplir, mais quoi si ce n'est sombrer dans l'oubli et me faire don de ton corps pour lancé le nouvel Eden?/
- ce corps m'appartiens ! et je ne veux pas devenir une de ces choses, une NMC sans volonté aucune, une créature que je chasse! Je ne sais même pas ce que tu es-
/ qui NOUS sommes plutôt, nous sommes des milliards en toi, plus nombreux que tes propres cellules, appelle nous Légion et sache que ce corps ne t'appartiens en rien, nous nous sommes glissés dans chaque élément du vivant attendant notre heure. nous chasser? Ce ne sont que des éveillés n'ayant pu attendre, les prémices du monde nouveau que Nous allons bâtir à notre mesure car Nous sommes supérieur, Nous sommes l'ultime étape de l'évolution.
à travers nous tu seras le surhomme, Tu ne seras plus mais tu deviendras "ça" l'ultime instinct créateur affranchi de tous Je dois ou Je veux/
-c'est finis ce délire nietzschéen? comment peux-tu te prétendre supérieur vous n'êtes que des monstres sans consciences-
/JUSTEMENT ! nous sommes l'Ultime l'instinct.
tu resteras le temps de voir l’avènement de notre ère, ensuite tu sombreras dans la véritable mort... L'oubli tout comme le reste de cette misérable fourmilière que vous appelez humanité, tu ne peux plus rien faire Nous avons déjà le contrôle de ton corps et tes compagnons ne sont plus en mesure de faire quoique ce soit/
contemplant ce vaste espace uniforme C.S.Roy tenta en vain de ce débattre mais rien n'y faire il ne pouvait se rapprochez de ce visage, sans point de repère ni sol d'où partir
-RHAAAA BORDEL! laisse moi approchez et je te ruines!-
/pourquoi veux-tu faire cela? ce sont des humains, de simples humains qui se sont prit pour des dieux et tu es leur création, pourquoi veux-tu leur venir en aide? tu seras leur Nemesis. Pourquoi te prends-tu pour un être humain? tu n'es pas humain, même toi tu n'es pas réel, qu'est-ce qui t'indique que tes souvenirs soient réels ? Que TU sois réel?
SOMBRES ! tu n'as aucune emprise ! /

soudain C.S.Roy senti une froidure mordante envahir ses bras comme, les contemplant il vit qu'ils étaient emprisonné dans un craquant de glace et là il comprit que ce n'était qu'une illusion

-tu dits que je ne suis pas humain, mais personne ne naît humain il le devient, Malgré que je sois un être crée je suis humain car... J'AI décidé que je l'étais!-

le monde uniforme commençait à vibrer, C.S.Roy commençait à s'y retrouver, il atterrit sur un sol et une onde se propagea quant il posa ses pieds, l'onde se sembla ricocher contre d'invisible paroi ensuite des murs apparurent puis des caisses, un plafond... Ils se retrouva dans la pièce le "lui" mutant devant lui. La forme restait humaine mais le l'aura rouge le nimbait et prenait forme... Maintenant il pouvait agir!
Se concentrant il enflamma ses poings explosant les blocs de glaces et émettant une aura verte foncé.
Il s'avança vers SON corps bien décidé à le reprendre

-c'est MON corps enfoiré et je vais le reprendre, je suis déjà supérieur! je me soumet à de normes parce que JE le veux... et puis un ça j'en ai déjà un avec Soma. Si je les aident c'est aussi Ma décision et tu ou vous... peu importe ce que tu es saloperie de NMC je vais te chasser comme tout les autres.
quand à mes souvenirs et la réalité de mon existence, aucune idée mais je suis ici pour le découvrir et pour cela je reprend MON COOOOOORPS!-

Il joint ses mains et frappe l'adversaire au visage puis agrippe l'aura et tire de toutes ses forces arrachant de plus en plus l'aura de SON corps... Quand il arriva à arracher l'aura ce fut le flash et se retrouva dans le monde infini ... à nouveau

/je vois, pas encore, tu n'es pas encore prêt à laisser glisser ton existence, Nous avons attendu des milliards d'années alors qu'est un vie humaine pour nous? quand à la fin de ta vie tu glisseras vers la fin nous serons là pour prendre notre/

- c'est ça t'attendra longtemps ! je te rapelles que tu entretiez mon corps et je ne crois pas que la faucheuse m'aura avant longtemps-

/la mort naturelle n'est pas la seule méthode, nous attendrons.../

L'univers éclata et il reprit conscience
**


[et bin putain c'est pas passé loin cette fois ! tu nous as fait peur]
<on a cru qu'elles t'avaient eu>

*C.S.Roy avais retrouvé son corps, le visage brûlé par le coup qu'il s'était donné, les mutations apparuent commençaient à fondre pour laisser apparaître le corps humain originel, les vêtement étaient en lambeaux il se tenait debout puis s'écroula à genoux et dit avant de s'écraser face contre terre*

-comment je me suis frappé? c'est pas logique et en plus cha brûle-

...
  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#102
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
Kimhiko marche. Elle reconnaît l'environnement alentours...
Les restes du temple de Namae...
Le sanctuaires des vieilles prêtresse plus précisément.
Ces vieilles grincheuses n'étaient plus depuis...

Le passage de cette organisation, avec ses gros camions, les hommes en combinaisons bleues, leurs armes à feu... et ces 4 lettres qui revenaient sans cesse... M.I.S.T. ... Ces hommes dans les camions, des hommes en blouses blanches...
Cette scène, elle ne l'avais pas vécue, elle l'avait vu au travers de l'esprit de Kurika, elle était en mission pour son maître quand le drame avait eu lieu...
Une mission bien étrange pour une prêtresse de son rang, le maître avait-elle eu un pressentiment' l'avais t-elle envoyé dans ce village lointain pour la protéger ?!
Dans ce cas, pourquoi était-elle dans cette situation... ?!

Mais oui, bien sûr ! Elle savait à présent où elle avais vu ce camion ! Celui qui était écrasé à l'étage où elle s'était réveillée L'étage où elle avait rencontré la petite et le tri-polaire...

La prêtresse marche encore, elle est à présent dans un grand jardin qui était autrefois magnifique.
A présent, il est dépouillé, comme le reste...
Ce jardin...
La fierté de Kuri, le jardinier du temple...
Kuri...

Comment se portait Kurika, s'était-elle endormi ?!
Pourvu que non...

Kimhiko se mit à courir.
Si elle était dans le jardin de Kuri, le bureau de son maître n'était pas loin...
Une fois arrivée dans le bureau, elle ouvre la porte avec force et...

[Et bien Kimhiko, est-ce une manière de rentrer dans mon bureau ?]
Maître que faites-vous là ?
[Il est naturel que je soit là, ma place est dans ce temple... Auprès des autres prêtresses]
Mais Yuki-sama... Justement !
Les prêtresses, elles ne sont plus là !
Elles ont été massacrées par ces hommes, le peu qui sont encore en vie sont enfermées avec vous... C'est ce que vous m'avez laissé sur papier...
Cette lettre précieuse que je garde dans mon sac...
[Que dis-tu ?!]
...

Le décors change, Kimhiko est de retour dans le monde réel... Si on peut l'appeler ainsi..
La prêtresse le sent...
Elle a sous les doigts des gravats, des morceaux de bois et des échardes qui s'enfoncent dans les paumes de ses mains.

Elle n'ose pas ouvrir les yeux, de peur de recroiser du regard la "chose" qui avait consumé C.S.Roy.

[Ah tu te réveille enfin !]
(Mon maître...)
[Tu as été bien imprudente...]
(Je sais...)
[Mais bon... tu as su gérer, je ne doutais pas de tes capacités, c'est bien pour ça que je t'ai permis d'être prêtresse malgré ton jeune âge ! Je sais que tu as en toi le pouvoir.]
(Maître, j'ai fais un étrange rêve... ?!)
[Il y a un temps pour les rêveries, et ce n'est pas le moment. Tu dois te réveiller]
(Mais maître...)
[RÉVEILLE TOI !!]

Kimhiko ouvre les yeux difficilement... Elle n'as plus la force de bouger.
Elle aperçoit C.S.Roy, il ne bouge plus et il a le corps contusionné...
Il n'est plus qu'une énorme blessure suintante.
La prêtresse se redresse difficilement, attire sa massue contre elle, prends appuie dessus et se relève.
Elle se traîne jusqu'à C.S.Roy.
S'écroule à ses côtés, pose sa main sur son torse ensanglanté.
Une faible lumière apparaît. La prêtresse transfert son Qi à son compagnon inanimé.
La prêtresse s'endort alors au côté d'un C.S.Roy en piteux état, mais un C.S.Roy humain et en vie...
Continuant de lui transmettre son Qi dans le but d'apaiser sa douleur...

Modifié par KimHiko, 06 mars 2011 - 16:42.

  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#103
Bensen

      El Profesor

  • messages 433
  • Inscrit(e) : 01 février 2011

  • Humeur du actuel : Rayonnante

Réputation : 60 (Se fait un nom)
<Le monte-charge continu sa descente vers les sous-sol du M.I.S.T>

Bensen pensant tout seul : (Bon sang !! Qu'est-ce que c'était que ça ?? ... J'ai bien fait de déguerpir mais bizaremment je me sens un peu mal de les avoir laissé la-bàs dnas cet état ... la bête est folle mais ce n'est pas de sa faute je le sais bien ... néanmoins il a sans doute tué Marcus et Pearl sans doute aussi. Le meilleur moyen d'en avoir le coeur net et de lui reposer la question et de toutes façons il n'y a qu'eux là haut alors pour avancer il vaudra mieux le faire en groupe. Pour cela je dois retourner au labo et prendre ce qu'il faut pour me proteger éfficacement des "Quitasueños" .. .et manger aussi "j'ai une de ces dalles"

<Le monte charge s'arrête, arrivé enfin au premier sous-sol : Section administrative et restauration>

"Mais avant de sortir comme ça rien ne vaut un tour d'horizon"

<Mettant en oeuvre sa paire de lunettes gadget Bensen commence une série de paroles pour se guider dans les menus d'un systeme informatique qu'il a apparement hacké>

"Général .... caméras .... plan général .... mosaique ... 1 ... zoom ... 3 .... zoom ... zoom ... OK" C'est bon la voix est libre ... à nous deux. "caméras ... BLIND ...."

Sortant du monte charge Bensen se dirige maintenant vers un ascenseur plus moderne celui là et qui nécessite un badge pour pouvoir y acceder

<PLIIIIP> ACCESS AUTHORIZED

Il appuit sur la touche - SS3 - ROBOT KIT NIK - est l'ascenseur commence sa descente rapide. Une fois en bas il se dirige rapidement vers son laboratoire et se muni d'un sac à dos qu'il remplit de diverses choses : Terminal de base de données, nanomachines régénératrices à injecter, pilules flash-strenght, détecteurs de masse et de mouvements, tazer et une trousse de 1er soins "Dora l'exploratrice".

"Voilà ça devrait allez maintenant au refectoire et on remonte illico presto ... si Pearl est encore en haut elle voudra elle aussi manger ou tout simplement dormir. pas de temps à perdre maintenant.

< Bensen se dirigeant vers l'ascenseur surveillé par une caméra qui a échappée à son contrôle / Etage du Refectoire / Cartons d'urgence / Prise de victuailles, fromages en boite, pain de survie, paté, rations, lait déshydraté ... assez pour tenir trois jours ... le tout avec de beaux marquages militaires ... tout ceci ne fait plus aucun doute, le "sponsor" ne sont pas une marque de lessive ... il fallait bien s'en douter>

(...monte-charge...)

<La porte s'ouvre sur la grande salle où tout à commencé, Bensen sort, check la salle aux IR : Personne ! Uniquement Sven, Kimhiko et le Katana boy qui continue à dormir dnas un coin. Il se précipite vers Kimhiko et Sven ... en veillant à éloigner la massue de la prêtresse>

"Heyy on dort pas là .. on dort surtout pas !!! Je vous ai apporté de quoi manger et vous soigner"

<Les deux endormis se reveillent en sursaus ... >
  • 0

Image IPB

"I was made to hit in America"
"Si tu travailles comme cette abeille ... tu t'rendras malade" (Baloo)

#104
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
"Heyy on dort pas là .. on dort surtout pas !!! Je vous ai apporté de quoi manger et vous soigner" braillât Bensen.

Kimhiko se réveille en sursaut.
Sa main toujours posée sur le torse de C.S.Roy, elle continuait de lui transmettre son Qi.

(Combien de temps suis-je restée endormie ?!)
La prêtresse referme les yeux pour mieux se concentrer.
L'homme est encore fortement amoché.
De grande brulures recouvrent son corps de part en part...
Comment se faisait-il que son don de régénération ne fonctionnait pas aussi bien sur lui que sur quelqu'un d'autre ?
Ce n'était pas si anormal que ça après tout, vu la démonstration de force dont elle avait été témoin.
Qui sait ce dont cet homme est vraiment capable.
Une chose cependant interpelle la prêtresse.
Pourquoi la "chose" l'avait-elle soignée, pourquoi l'avait-elle épargnée ?
Alors que cette même créature menaçait de s'en prendre à l'homme en blouse blanche ?
L'homme en blouse blanche...
Ce devait être lui qui braillait comme ça...
Ah...


"A manger dis-tu ?
Je n'en ai pas besoin, j'ai mes racines séchées.
Par contre, il me faut de l'eau, mes réserves sont épuisée...
Je n'ai pas besoin de soin non plus.
Personne ne m'injecteras de nanomachin dans les veines !
Par contre, lui oui.
Il a besoin de manger et d'être soigné."

La prêtresse se relève est récupère sa massue qui avait été écartée par Bensen.
La tête lui tourne, l'air ambiant est chaud et sec.
Et C.S.Roy ne bougeait toujours pas...
La prêtresse se penche au dessus de lui, observe sa respiration, prends son pouls...
Tout semblait être en ordre pourtant, il ne se réveillais pas.
La prêtresse fouille dans son sac et en sort son baume nettoyant et cicatrisant.
Elle entreprends de lui en mettre sur les blessures du torse et des bras.
Au moment de lui en mettre sur le visage, elle s'aperçoit de quelque chose d'étrange.
C.S.Roy clignait des yeux rapidement.
C'était comme si son esprit était en train de combattre quelque chose.
Mais quoi...


"Hé... Hé...
Kimhiko secoue son compagnon, des larmes perlant le long de ses joues.
Réveille toi, réveille toi...
Tu ne dois pas dormir !
Les Quitasueños risquent de t'emporter !
REVEILLE TOI !!
TU NE DOIT PAS DORMIR !!
C'est pas toi qui disait que tu ne dormais jamais ?!
Hé... Hé..."
  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#105
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
*à force d'être secoué comme un prunier il se décida à donner signe de vie*

-mais je dors pas je récupère nuance!-
<c'est vrai on avait émergé au son du mot nourriture>
[on avait juste la flegme de réagir et l'on était en plein débat interne pour savoir comment il avait réussi à se frapper de l'extérieur]
-deux hypothèses sont discutées, l'une est que j'ai pu m'extra-corporalisé et me filer une baigne et l'autre est que je me suis tellement persuadé de me frappé que le corps à réagi en coséquence-
<MAIS ON S'EN FOUT A LA BOUFFE!!!!!!>
-première fois que je vois l'otakgeek ne pas discuter dans de tels débats-
[HEY ! soma c'est moi, c'est ma réplique]

*prend l'air profondément blasé$

-en plus comment dormir avec ces deux là?-
[deuxièmement nous ne sommes...]
-arrête avec ton nous, on croirait entendre Légion-

*se parle en pointant son corps du doigts*

-z'avez compris là? c'est moi le boss en mon corps !!! essayer encore de prendre le contrôle en je me fous au micro-ondes! NAN MAIS! bêtes mitochondries parasites! et ça ose se faire passer pour des organisme symbiotiques-
<on peut manger là j'ai faim>
[z'allez me laisser en placer une ?]

*dit-il en appuyant sur la brûlure au visage*

-AIE mais t'es dingue-
<trop faim que pour sentir quoique ce soit...>
[maintenant que j'ai votre attention, donc Notre corps n'est pas si endommagé que cela]
<c'est cela oui endommagé superbe terme, un tour chez le garagiste et il n'y paraîtra plus, au lieu de raconter des conneries on peut manger?>
[NAAAAN, pas tout de suite. à part celle au visage dont on discute encore la méthode les autres sont dues à une mutation rapide puis d'une dégénérescence rapide de ces même mutations, lors de la mutation les mitochondries s'étendent et quand les mutations ont... fondues, je ne vois pas d'autres termes,] les mitochondries ont vite réintégré le corps "normal" provoquant des brûlures à force de s'agiter et de rentrer et sortir des cellules. les phénomènes est connue des chasseurs de NMC mais d'habitude on n'en revient pas]
-en parlant de fondre on bougerait pas? on est en plein milieux de fluides vitaux restes des mutations-
<A LA Bouffe>
-ouais oauis, ce que j'ai mal de crâne moi-

*Commence à se lever*
  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#106
Bensen

      El Profesor

  • messages 433
  • Inscrit(e) : 01 février 2011

  • Humeur du actuel : Rayonnante

Réputation : 60 (Se fait un nom)
Bensen (qui avait enfilé maintenant un sweet à capuche ressemblait moins à un scientifique)s'approche de Kimhiko est lui tend une bouteille d'eau.
<Kimhiko se jette sur la bouteille et bois à grosses gorgées>
"Merci pour tout à l'heure, je crois que je te dois une fière chandelle. Il y a encore à manger en bas au cas ou ... et de toutes façons nous pourrons y revenir si mon piratage du système tiens encore"
S'approche du mythocondriaque : "voilà pour vous, un peu à manger. Merci d'être encore en vie on a besoin de vous ... pour le reste .. enfin vous comprendrez sans doute "
<se fixe et réfléchi>
"Marcus ? ou est Marcus ? je suis sur que vous en savez quelque chose ...."
<pas de réponse, ils sont bien trop occupés à manger>
<Parles dans sa barbe>
"on pourras descendre quand vous voudrez mais on devrait pas rester moisir ici, les rêves ne sont pas surs, les murs ont des oreilles et les fenêtres des yeux. EN bas on sera plus en sécurité ..."
<S'assoit et attend une réponse, un geste, une décision ...> - (mais pas un coup de massue)
  • 0

Image IPB

"I was made to hit in America"
"Si tu travailles comme cette abeille ... tu t'rendras malade" (Baloo)

#107
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
*dévore les provisions plus vite qu'un anti-corps phagocytant un microbe*
<RHAAAAAA MANGER!!!!! quelle extase>
-euh marcus...-
[les tas de cendres ne nous ont pas donné leur noms]
-la prêtresse avait pas ramassé un badge à moitié illisible?-
[si mais... le porteur n'est "légèrement" plus en mesure de nous dire quoique ce soit]
-hum...-
<je suis au paradis>

*demande à kimi*

-tu as encore le bagde ?-
  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#108
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
Kimhiko fouille dans son sac à la recherche du badge.
Mais où l'avais t'elle mis ?!
Il y avait tellement de foutoir là-dedans...
Soma dit entre deux bouchées :


"[Ahhh, les femmes toutes les mêmes ! Si elles pouvaient mettre leur maison dans leur sac, elles le feraient...]
- Toi, je t'ai pas sonné ! Attrape plutôt ça !"

La prêtresse lance à Soma son insigne usé.
Celui-ci le rattrape avec adresse et le contemple avec nostalgie.


(Je me demande ce que ce truc représente pour lui... Enfin, un truc en moins là dedans, c'est déjà ça...)

Kimhiko continu de fouiller, sort une racine de son étui et la grignote en trifouillant avec rage.
Quelque chose lui coupe le doigt. C'était le papier avec le code inscrit dessus.
Si il était là, ça voulait dire que le badge n'était pas loin.
Elle sort le tout, regarde le badge où les lettres sont à moitié effacées et le tends à Bensen.
Puis, elle ouvre le papier et lit à haute voix :


"Ça vous évoque quelque chose PDT55O2F9 ?
Pour moi, PDT veux dire Pomme De Terre...
Mais... ici, ça pourrais dire bien des choses...
Ah, je l'ai trouvé dans une blouse blanche tâchée de sang, accroché sur un porte manteau.
C'était au premier sous-sol, un laboratoire qui fait froid dans le dos, avec tout ces trucs conservés dans du formol..."

La prêtresse regarde Bensen droit dans les yeux et lui dit :

"Si je t'ai sauvé, c'est avant tout parce-que tu es la clé à toutes nos questions.
Tu es le seul à connaître les lieux, à savoir ce qui se trame ici et à connaître les gens qui nous observent.
Et, ne t'imagine pas que ma massue est ma seule arme, même si, c'est de loin celle que je préfère !
Je ne sais pas si tu es impliqué dans la démolition de mon temple et dans le massacre des autres prêtresse, et je ne veux pas le savoir.
Je veux juste savoir où mon maître est maintenu prisonnier, et la sauver.
Je ne te ferais pas de mal, mais ne t'avise pas de nous trahir ou de nous mettre des bâtons dans les roues !
Je doute toutefois que ton ami Marcus soit encore en vie, une chose est sûr, ce n'est pas C.S.Roy qui l'as tué, car c'était sa blouse que j'ai retrouvé tâchée de sang...
Et Soma à dit que c'était des hommes en blouses blanches qu'il avait carbonisés.
Bien, maintenant, amène nous jusqu'à ton laboratoire, si tu pense que l'endroit est sûr..."
  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#109
Bensen

      El Profesor

  • messages 433
  • Inscrit(e) : 01 février 2011

  • Humeur du actuel : Rayonnante

Réputation : 60 (Se fait un nom)
<Vue générale d'une salle de contrôle ... un homme assis devant une mosaïque d'écrans scrute et décrit la situation tactique à un homme en costume noir debout derrière lui>

"Monsieur, la jeune fille continue sa route ... actuellement au niveau B2 couloir central, encore loin de la zone X. Le groupe de 3 personnes sont encore en C3, ils ont l'air de se concerter". Zone SS1 et SS2 encore vide ... les mouvements tout à l'heure en SS3 ont été confirmés comme étant ceux de Bensen.

<L'homme d'un air grave répond sans hésitations>

"Laissez les faire il ne nous sont d'aucuns danger pour le moment, placez le labo de Bensen sous surveillance "simple+" et occupez-vous de suivre les mouvements de la gamine. Placez un marqueur dessus je veux tout savoir de ses mouvements ... qu'elle ne finisse pas comme l'autre gamine. Assurez vous néanmoins qu'elle atteigne sa cible"

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

<Bensen regardant lui aussi Kimhiko dans les yeux en l'écoutant prend la parole à son tour> :

"Alors :
1. OUI je connais les lieux et ceux qui sont responsables en son sein
2. NON je ne sais rien de ton histoire d'enlevement et de temple de prêtresse et grenouille de bénitier
3. Je n'ai pas l'intention de trahir comme tu dis car pour trahir il faudrait que vous ayez une utilité pour quelqu'un et que j'en tire parti .. et là je ne vois vraiment pas ce que je pourrais tirer de la situation
4. le PDT est le Protocole De Transfert ... mais ça je vous l'expliquerais en bas.
5. le soit disant labo que vous avez vu n'est qu'un leurre avec des prothèse en matière synthethique pour faire fuir les curieux. Cependant cela n'est pas de mon ressort, je n'en sais pas plus.
et 6. euuuhhh t'a un bout de plante séchée sur la joue ...

<Kimhiko regard froid comme toujours>
"Deuxième avertissement, gares à toi si tu nous trahis !"

<Soma avec un air candide (pour une fois)>
"Bon bein si on y va pour trouver quelque chose c'est déjà mieux que de rester ici sans rien trouver du tout"

"Alors OK prenons la direction de mon labo pour essayer de tirer ça au clair mais je vous previens je n'ai sans doute pas toutes les réponses. Si ce que tu dis est vrai concernant Marcus alors la situation de Pearl doit être identique <pensif> continuons maintenant ça ne sert à rien de se lamenter maintenant.

<Les trois prenant la direction du monte charge>
<La focale d'une caméra les suit pendant qu'ils marchent en groupe>

"Monsieur, le groupe prend la direction du monte-charge ... que dois-je faire ?"
"Laissez les descendre, voyons voir ce qu'ils comptent bien faire maintenant. Isolez les secteurs SS7 et SS8. Ne les laissez pas rejoindre le générateur au cas ou ils auraient l'idée de couper tout. Scellez également les cellules de confinement.

<D'un doigt l'opérateur ferme des circuits et verrouille un à un les secteurs mentionnés par l'homme en noir>

<En face du monte charge nos trois vadrouilleurs commence à descendre un par un jusqu'au niveau SS-3>
<Se retrouvent devant le labo de Bensen "section Robot Kit Nik" .... entrent et s'assoient confortablement sur des chaises devant un ordinateur. Bensen commence à faire des recherches tout en parlant à ces deux nouveaux compagnons de galère>

"Le Protocole De Transfert dont tu m'as parlé tout à l'heure est, pour faire simple, une série de conditions établies afin de permettre le transfert de personnalités et/ou de modifications d'une partie du cerveau ... (rien à voir avec les réseaux informatiques) ... afin de permettre un résultat souhaité. Je ne sais pas trés bien l'expliquer car Marcus n'a jamais été trés bavard à ce sujet. Il ne m'a pas dit grand chose si ce n'est que le sujet test n°1664 <se tourne vers Soma> été atteint de folie psychiatrique et qu'il était volontaire pour cette expérimentation. Le doute persiste sur sa réelle vocation à devenir un "sans sommeil" car sa folie l'empêchait lui même de prendre des décisions. La seule raison valable était apparemement de fuir la prison psychiatrique où il avait été interné aprés avoir "mangé" son colocataire de cellule. DONC : ce protocole aurait subit une altération pendant le processus de transfert, l'origine étant un virus informatique qui aurait progréssé à travers le réseau à une vitesse impréssionnante ... à se demander si certains pare-feu n'avaient pas été volontairement éffacés afin de permettre ce résultat. Beaucoup on dit que AYA y été pour quelque chose d'autres ont accusés les informaticiens et l'histoire c'est tassée avec d'autres expériences.

<Regardant Soma>

"Ils t'ont enfermés dans une cellule plus bas ... tu en est ressorti avant-hier ... apparement libéré de nouveau par un virus informatique qui a mystérieusement ouvert ta cellule ... le mystère plane mais a été suffisant pour que les Sections Administratives / Logistiques et bons nombres de Scientifiques quittent le complexe et se réfugient dans un centre plus éloigné de celui-ci ...

<Soudain Bensen comme frappé par l'évidence se tape sur la tête>

"MAIS oui !!! PDT55O2F9 !!! c'est sans doute le mot de passe du compte de Marcus à propos du cas Soma ...."

<Tapotant à une vitesse digne d'une dactylographe exerçant dans un tribunal, Bensen commence à accéder aux données informatique .... >

"YEEEESSS ça marche c'est ça ^^ ...."

<Bensen commence à chercher des données et tombe sur un memo de Marcus. Le lisant il en fait un résumé à voix haute>

" Le sujet test n°1664 <se tourne vers Soma> été atteint de folie psychiatrique et était volontaire pour cette expérimentation. Le doute persiste sur sa réelle vocation à devenir un "sans sommeil" car sa folie l'empêchait lui même de prendre des décisions. La seule raison valable était apparemement de fuir la prison psychiatrique où il avait été interné aprés avoir "mangé" son colocataire de cellule. DONC : le protocole de transfert aurait subit une altération pendant le processus de transfert, l'origine étant un virus informatique qui aurait progréssé à travers le réseau à une vitesse impréssionnante ... à se demander si certains pare-feu n'avaient pas été volontairement éffacés afin de permettre ce résultat. Beaucoup on dit que AYA y été pour quelque chose d'autres ont accusés les informaticiens et l'histoire c'est tassée avec d'autres expériences plus ou moins concluantes. La libération du sujet n'est pas d'actualité sauf si bien sur l'autre experimentation tient ses promesses. D'autres sujets sont disponibles avec ou sans leurs consentements"

<Bensen arrete là la lecture, se rendant compte que son ami Marcus n'était en fait qu'un vil scientifique expert en génétique et neuro-chirurgie ... Ce serait-il joué de lui ? Qui était-il vraiment ?>

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

"Monsieur, le groupe a atteint le labo, il semblerait que notre sytème de surveillance ai été piraté. Je n'ai pas de visuel sur eux, ils sont hors caméras"
"Dépéchez vous de retablir la ligne ... "
<et d'une voix monocorde>
"Envoyez deux renifleurs en mode charlie !

<Une trappe s'ouvre dans un couloir ... deux cafards miniatures en sortent ... et commence leur course folle>

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

"Soma, Kimhiko ... je tiens à m'excuser à propos des méfaits de Marcus, je ne savais pas, je ne comprend pas .... reposais vous, vous en avez besoin. Je prendrais le premier tour de garde, j'ai encore des recherches à faire pour trouver une échappatoire. Ne vous inquiétez pas j'ai placé des detecteurs telluriques dans la salle pour contrer une apparition de "Quitasuenos", ils sont couplés à des detecteurs sismiques en cas de presence humaine ... et en dernier recours je peux générer une barrière de photons aveuglante ... mais c'est trés trés lumineux ... autant dire qu'un quitasueños lui-même finirait avec un labrador et une canne"

"Bonne nuit les petits ... (bonne nuit nounours)"
<flute flute fluuute fluuute fluuute flute flute flute flute flute flute fluti fluti fluuuute>

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

<Salle de contrôle des caméras ... une femme entre, tailleur, lunettes et chignon ...>

"Marcus ! Le conseil de sécurité se rassemble en salle de briefing ... ils requièrent ta présence"

<L'homme en costume noir jette un dernier coup d'oeil au Labo de Bensen, se retourne et sort de la salle>

Modifié par Bensen, 14 mars 2011 - 23:01.

  • 0

Image IPB

"I was made to hit in America"
"Si tu travailles comme cette abeille ... tu t'rendras malade" (Baloo)

#110
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
-et des vêtement on peut en trouve? ce n'est pas que les miens puent et soient en lambeaux maiiiis-
*dit-il en prenant ses loques encore dégoulinantes*
-en plus cela ne sèche pas-

*en arrivant devant le labo de Bensen*
<"section Robot Kit Nik"... hum si on enlève un T...>
-MAIS C'EST FINI OUI ?-
<rhoo si on peut même plus rigoler>
*entre dans le labo*

*après le longue explication*
-Hey c'est moi le principale et non eux!!! ils squattent-
[visiblement non]
-tu veux une preuve soma?-
[y en a?]
-à qui l'entité mitochondriaque multiple à causé? A MOI !!! vous vvous étiez dehors !-
<effectivement>
[tais-toi toi!... j'ai horreur d'avoir tort mais cela veut dire que c'est toi qui à bouffé un gars et était dérangé]
-MAIS NAN!! je n'en ai aucun souvenir-
[qui te dit qu'ils soient vrai?]
-euh... ma libération de mitochondrie?-
[pffff aucune preuve]
-... t'as aucun souvenir plus lointain toi peut-être?-
[ha merde si...]
<moi non aucun>
[QUOI ?!?] -ne me dit pas que le corps c'est... et le mien-
<le corps quoi?>
-non rien-
[oublie l'otakgeek cela vaut mieux]
-ha merde alors-

*pensif puis dit à soma*

-dormir, suivant toit suis un sans-sommeil... je fais comment?-
[de toute façon le premier truc qui entre je l'explose suis pas d'humeur dire que je suis dans le corps de l'autre tâche]
<quelle tâche>
[quand on se serait fait choper?]
  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#111
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
Kimhiko qui s'était assise à cause de la fatigue se lève d'un bond.
Frustrée, elle s’essuie la joue d'un revers de la main.
Elle tape du pied de colère.
"CRAC"
Elle soulève sa rangers et vois alors une toute petite bestiole écrasée.


"CRAC ?! Pourquoi une si petite bestiole fait CRAC ?! Et depuis quand ça fait CRAC une bestiole ? Étrange..."


xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

COUIIIIIIIIIIIIIIICCCCCCC GRRRRRRRRR PSSSHHHHHHHHHHhhhhhhh
"Monsieur, nous avons perdu le contact avec le second renifleur !"

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

La prêtresse s'adresse à Bensen :

"Bon, si je comprends bien, ton pote là... Euh... Marcus, il fait partit de la bande de savants fous !
Ce serait peut-être mieux que Soma, l'ai carbonisé en fait...
Ça ferait un de moins...
Et tu nous dit que le laboratoire que j'ai fouillé était un faux ?
Impossible !
Je sais reconnaître l'odeur de la mort quand je la sent !
Et je peux te dire que le sang, n'avait rien de synthétique !
De plus, que ferait la blouse de ton pote là-bas avec son "multi"pass magnétique et le code donnant accès à ses recherches ?!"

"J'avoue que j'aurais bien besoin de me changer aussi !
Même si mes vêtements ne sont pas en lambeaux contrairement aux tiens...
Je ne suis pas à l'aise dans cette toge déchirée et brûlée.
Mon maître serait indignée de me voir dans cette tenue.
-Une prêtresse se doit d'être soignée et présentable, quelles que soient les circonstances !-
(dit Kimhiko en imitant la voix haut perchée de Yuki-sama)

Elle me le répétais sans cesse quand elle m'as recueillie au temple..."

Kimhiko fait ensuite face à C.S.Roy.

"Je voulais te poser une question, C.S.Roy, où plutôt, elle s'adresse particulièrement à Soma...
Quand je vous ai demandé un objet à Onee et toi, tu m'as balancé ton insigne en me disant d'y faire très attention car tu y tenais.
Et quand je te l'ai rendue, tout à l'heure, j'ai ressenti quelque chose...
Depuis, une question me trotte dans la tête...
Même plusieurs je dois avouer...
C'est quoi ce vieux badge ?
Et pourquoi est-ce que c'est écrit M.I.S.T. dessus ?
J'ai bien compris que ça avait un rapport avec ta mutation de tout à l'heure.
Je veux comprendre pourquoi la "chose" ne m'as pas attaquée.
Je n'était pas en état de combattre, elle aurait très bien pût me tuer !
Au lieux de ça, je me suis réveillée en pleine forme ! Je ne comprends pas !"

Kimhiko s'installe de nouveau assise en tailleur et s'adresse à Bensen.

"Eh bien, tu nous as dit à Onee-chan et à moi que tu avais du café ici, tu ne nous en propose pas ?
A moins que c'était juste dans le but de nous amadouées...
En tout cas, après le somme que j'ai fais tout à l'heure, impossible de dormir à présent donc je propose de monter la garde avec toi.
Ma massue ne serait pas de trop en cas d'attaque je pense !
Ah... Oui, au fait !
Rends moi l'aiguille s'il te plaît.
Je sais que tu l'as récupérée, je ne l'ai pas retrouvée en la cherchant !"
  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#112
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
-manger un type pas possible que ce soit moi-
[faudrait vraiment être un morfal pour bouffer un type alors qu'on donne des repas]
<il a l'air bon>
-QUOI?-
[bon bin on a la confirmation]
-mais si c'est le sien pourquoi Légion... rhaaa je ne comprend plus rien-
[et je ne peux même pas le tuer]
<tuer qui?>
[rendort toi cela vaut mieux]
-je sens la migraine poindre...-
<moi je vais bien>
[MAIS TU VAS LA FERMER OUI ?!]
<hey pourquoi t'es méchant tout à coup>
[faut que je tue quelque chose... faut vraiment que je tue quelque chose pour me caler]

*remarque que la prêtresse lui parle*

[hein quoi? esprit embrouillé... corps à qui? RHAAAAAAAA massacrer !!!]
-hey c'est Mon insigne!!... enfin je crois je ne suis plus sur de rien là.
Dans "mes" souvenirs le M.I.S.T étais différent... je ne sais plus, il me faut du temps pour remettre mes idées en place.
[tuer, mutiler, détruire, rompre, torturer tue, tu tu tu...]
-tiens soma bug, l'otakgeek à eu raison de sa raison... si tant est qu'il n'en ait jamais eu une.
Chose? tu veux parler de Légion je présume? Je suppose que son but étant d'émettre un appel pour réveiller les mitochondries dans tout les organismes il s'est dit que les réveiller dans un corps affaibli ne serait pas le plus judicieux, ce qui est sur c'est qu'il ne l'a pas fait de bonté de coeur-
  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#113
Bensen

      El Profesor

  • messages 433
  • Inscrit(e) : 01 février 2011

  • Humeur du actuel : Rayonnante

Réputation : 60 (Se fait un nom)
INTERLUDE (souvenez vous Angelo; c'était il y a 15 ans)

Kimhiko : "il me faudrait des vêtements, les miens sont en lambeaux."

Bensen : "Des vêtements oui bien sur. Oun café d'abor ? Pa dé probleme vien par là. Sa né prendra qué quelqué ségonde. Régarde, dé l'eau chaude, oun sachet, yé touye .. é boila Nescafé kimhikoccino (quimico-ccino)"

<Kimhiko ... regard éberlué ...>

"Euhhh et mes vétements ??"

<Bensen sourire dragueur>

"Vétéments ?? Ah ma yé né pas dé vétéments ^^"


Note de l'éditeur : et Bensen mourrut dans d'atroces souffrances ^^

Modifié par Bensen, 18 mars 2011 - 01:59.

  • 0

Image IPB

"I was made to hit in America"
"Si tu travailles comme cette abeille ... tu t'rendras malade" (Baloo)

#114
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
Quel drôle de comportement se dit la prêtresse.
Tout d'abord, l'Otakgeek et Soma qui ne savent plus ce qu'ils racontent...
Ensuite Bensen qui pète tout simplement une durit ?
Kimhiko connaissait ces symptômes.
Du gaz Niaprazine.
Un gaz non toxique mais très puissant qui faisait délirer quiconque en aspirait une trop grande quantité.
La prêtresse déchire trois bandes de tissu du bas de sa toge qui petit à petit raccourcissait !
Elle prends la bouteille d'eau et asperge celles-ci.
La prêtresse attache un des morceaux de tissu, devant son nez et sa bouche.
Le tri-polaire la regardait d'un air interrogateur.


"C.S.Roy, ne bouge pas ! Tu ne dois absolument pas respirer ! Tes deux autres toi ont été contaminés par un gaz hilarant."

Elle va jusqu'à C.S.Roy et lui couvre les voies respiratoire de la même manière.

"Aide moi, maintient le je dois réussir à lui mettre ça aussi !"

C.S.Roy, attrape alors Bensen qui se débattait comme un fou furieux en continuant de rire et de déblatérer des idioties aussi grosse que lui.
Impossible de lui attacher le foulard de fortune.
La prêtresse attrape une tasse à café sur le bureau et assène un coup sur le haut du crane de Bensen.
Celui-ci s'affaisse de tout son long sur le sol.


"Là au moins, il ne bougeras plus... Et ça lui apprendras a se payer ma tête !
Héhé.
De toute façon, je peut le soigner par la suite"
-Un peu barbare mais efficace-
"Barbare moi ? Mais non..."

La prêtresse se penche sur l'homme inconscient.
Elle lui soulève la tête et lui attache le foulard sur la bouche.
C.S.Roy le tenait toujours.
Ensuite, elle s'accroupit à sa hauteur, pose délicatement ses mains sur la bosse de Bensen et murmure une incantation pour le guérir.
L'homme ouvre les yeux, il avait retrouvé ses esprits.

"Bensen, n'enlève surtout pas ton foulard si tu ne veux pas te recevoir un autre coup sur le crane !"

La prêtresse fait le tour de la pièce en entreprends de fouiller tout les placards pour trouver des tenues de rechange.
Tout en cherchant la prêtresse explique la situation à Bensen, toujours dans les vapes.


"Tu as été victime d'un gaz hilarant.
Je n'ai pas eu le choix que de t'assommer.
Tu ne te laissais pas faire lorsque nous avons essayer de te mettre le foulard, sans ça tu serais encore en plein délire !
Je pense savoir d'où provenait ce gaz. Tout à l'heure, j'ai écrasé une bestiole. Et celle-ci a fait "CRAC", je pense que j'ai cassé la capsule qui contenait ce gaz à ce moment là.
Mais c'est étrange...
Qu'est-ce qu'un insecte ferait avec ça, à moins que ce soit tes supérieurs hiérarchiques qui soient derrière ça...
Je me rappelle que les moines combattants utilisaient le Niaprazine pour lancer leurs assauts.
Nous devons nous préparer à être attaqués à tout instant !.
Ah oui, et C.S.Roy, tu diras à ton "Légion" que c'était une belle erreur de sa part que de me sous-estimée !"
  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#115
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
[nan mais je risque rien, il en faudra plus que du gaz de ce genre que pour me mettre K-O]
-elle te parlais pas BORDEL!!!! hum...
donc non je ne le lui dirais pas vu que je ne compte pas le revoir, là il est refoulé loin très loin et il est très bien où il est déjà que je ne pense pas pouvoir le maîtriser la prochaine fois... Pour être honnête je ne sais même pas comment je suis arrivé à le repousser la première fois-
[comme je le disais ce genre de gaz est sans effet sur nous, les mitochondries l'élimine d'elles même, il faudrait un neurotoxique puissant ou un gaz qui remplace l'oxygène, dans ce cas elles auront faire tout ce qu'elles veulent sans sans oxygène elles étoufferont... Nous avec]
-et notre comportement qui à première vue pourrait paraître étrange résulte d'un conflit interne quand au possesseur originel du corps, ce qui pose un certain paradoxe d'ailleurs...-
<GHéééééééééé...>
[rectifications faites un est atteint, enfin tant mieux on récupérera le corps]

* KimHiko le ragarde bizarrement*

[bha quoi?]

*à kimhoko*

-donc tu crains une attaque et ce gaz te rappelle quelque chose... hum-
<GHEUWA!!>
-... bon au boulot-

*inspecte la pièce soigneusement*

-tu en penses quoi Soma-
[quitte à tenir un siège autant le faire dans un endroit nous donnant quelques avantages]
-effectivement-

*à bensen*

[Hey Doc Hyde elle a un truc d'intéressant cette pièce? au sinan on se casse d'ici avant d'être obligé de repeindre les murs façon viscères]
-ce que Soma veut dite c'est qu'a moins que la pièce n'ai un intérêt stratégique quelconque on devrait évacuer les lieux au plus vite la sécurité de ce local étant remise en question, il n'y aurait pas une armurerie ou mieux un cuisine? les réserves de balles on peut pas les manger alors qu'avec des réserves de nourritures je peux tenir un long siège-
[et des vêtements !!!! On doit trouver un foutue armurerie pour s'équiper en conséquence et dégoter des tenues de combat... ça nous économisera de l’énergie ]
<NYAAAAAAAAAAA>
-houla les effets durent...-

Modifié par C.Sven.Roy, 22 mars 2011 - 22:43.

  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#116
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
"Armurerie ?
Je me souviens maintenant que mon maître m’a dit que les camions du MIST qui était présents lors du siège de mon temple étaient pleins d’armes en tout genre…
Peut-être que le camion écrasé en plein milieu du rez-de-chaussée est pareil ?
Si c’est ça, ça vaut peut-être le coup de remonter !
Peut-être aussi qu’on pourrait voir Onee-chan et Kuri au passage…
(Kuri, j’espère que tu vas bien et que tu prends bien soin de la petite…)
Prof’, je fais comme chez moi hein ! Je me permets de fouiller."

L’intéressé était à son bureau, occupé à manipuler ses ordinateurs et ses machines. Il hochât la tête sans piper mot.
C.S.Roy, quand à lui, était en pleine discussion avec ses autres lui. A première vue, il se mettait d’accord avec lui-même sur la meilleure façon de procéder.
La prêtresse ouvre donc un placard. Ses yeux s’illuminèrent quand elle vit ce qu’il renfermait.
Elle attrape un pull, une veste sans manches et un pantalon large avec plein de poches, les balancent au mitochondriaque en lui disant :


"Tiens Roy, ça devrait t’aller ça ! Ce n’est pas génial mais ce sera toujours mieux que tes haillons !
Voyons voir ce que je peux trouver pour moi…"

Elle fouille encore, en jetant par terre la moitié des affaires entassées dans l’armoire en métal.

"Pas ça, ni ça, ça c’est ignoble…
Qui aurait idée de se vêtir de la sorte ?!
Ca non plus… Ah ça ! Parfait !"

Kimhiko sort de l’armoire et tends à bout de bras une robe de coton beige. Le regard triomphant comme si elle avait vaincue à elle seule une douzaine de Quitasuenos…

"Ainsi donc, il y a des femmes qui travaillent ici en dehors de l’autre folle dans son tableau !
Mais je ne vais pas m’en plaindre…
Cette robe est parfaite ! Légère, simple et résistante ! Comme je les aime !
Bensen, s’il te plaît. Assure toi que la salle n’est pas surveillée par les caméras ! Je n’aimerais pas qu’une vidéo de moi en train de me changer se retrouve sur le net…
Ah tient ! Qu’est-ce que c’est que ça ?"

La prêtresse sort une boîte en carton contenant des barres emballées et lit l’emballage.

"Barre nutritive hyper-protéinée.
Ah, tient, c’est bon pour toi ça, Roy ! Tu pourras utiliser ta parasite énergie comme ça !
Mais… ce ne sera pas suffisant.
Il nous faut trouver la cuisine…
Tout les batiments de cette taille sont forcément équipés de cuisine…
En parlant de cuisine, c’est un frigo que je vois là ?"

La prêtresse joint le geste à la parole et ouvre le frigo en quête de quelque chose d’intéressant à se mettre sous la dent.
C’est bien bon les racines séchées quand on en as l’habitude. Mais rien ne vaut un bon repas !
A sa grande déception, la prêtresse ne voit qu’une bouteille de vin « Mouton Rothschild ».
Elle la sort et lit à voix haute une inscription faite à la main :

"Pour Marcus. De la part de Bensen et de toute la section Robot Kit Nik."

Cette fois, Bensen réagit. Il frappe un grand coup avec le plat de sa main sur son bureau.
Puis, il se penche de nouveau sur son ordinateur, et reprends ses manipulations de plus belle.


(Bon, sujet sensible, je vais évité de faire remarqué que l’endroit est plutôt miteux pour y avoir des bouteilles de vin à 500 euros pièce…)

Elle repose la bouteille de vin là où elle l’avait prise.
Kimhiko aperçoit alors une bouteille de Pepsi. Elle la prend, et la range dans son sac.
Elle referme le frigo.
La prêtresse ramasse sa massue, pose les barres chocolatées sur le bureau à côté de Bensen toujours affairé sur son ordinateur, fait quelques pas, se tourne à droite, à gauche.
Il fallait bien qu’elle se rende à l’évidence, aucune partie de cette pièce carrée n’était assez caché pour lui laisser un peu d’intimité, juste le temps de se changer…


"Je vais me changer.
Retournez-vous !
Celui que je vois faire un mouvement, je l’assomme !"

Hochement de tête de la part de Bensen.
Signe de la main de la part de C.S.Roy qui était toujours en plein débat avec lui-même.

  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#117
Bensen

      El Profesor

  • messages 433
  • Inscrit(e) : 01 février 2011

  • Humeur du actuel : Rayonnante

Réputation : 60 (Se fait un nom)
Tout de suite aprés l'attaque neuro-toxique de la part d'un des cafards electroniques, Bensen compris que l'équipe de surveillance était sur leur traces. S'installant devant son PC il entreprenait un long travail en rentrant des lignes de codes et téléchargeant toutes sortes d'informations sur son personal-pad afin de percer un secret ou trouver une solution et permettre la fuite des trois comparses loin du labo. Jouant du clavier et de la souris il finit finalement par pousser un cri de joie et de nouveau tapa sur son bureau :

"Et paf j'ai trouvé la sortie ... yuuuhuuuuu Kimhiko tu peux ouvrir le vin !!"

S'approchant de Kim et Soma qui s'affairaient maintenant à manger il leur parla d'une voix intelligible et trés clairement il annonça le plan tout en ecrivant sur une feuile de papier :

"J'ai trouvé la sortie ! Hyper simple je vous fais le plan : on file au SS-6, on neutralise la centrale electrique pour créer une panne de courant, les générateurs de secours se mettent en branlent coupent les systèmes de sécurité et débloquent les sorties de secours. La plus proche étant celle située en SS-2 ça ne devrait pas poser de problèmes" Des questions ? Pas de questions ? OK "raus" !"

Cependant pendant qu'il expliquait à voix haute Bensen écrivait une autre histoire sur le papier

- CAFARDS PIEGES
- SALLE SOUS SURVEILLANCE CAMERA ET AUDIO
- AIS PU LIRE BOITE MAILS DE MARCUS
- PEARL DECEDEE / ONEE-CHAN MAINTENANT SOUS SURVEILLANCE DU M.I.S.T
- ARMURERIE EN SS-3. ON VA LA-BAS. JE CONTROLE CAMERA OK
- PARLEZ SANS GENES / FAITES COMME D'HABITUDE ON CONTINUE L'EMBROUILLE

PS : DSL KIM ILS ONT DU TE VOIR AVEC LA CAMERA MAIS JE NE POUVAIS EVENTER LE SECRET ...

kimhiko qui avait déjà servit le vin (comme quoi les prêtresses buvaient du vin dans les temples) ... Bensen en bu une gorgée et se delecta de ce fin nectar :

"Plutôt dans notre estomac que dans celui de Marcus."

Et d'un ton joviale

"Kim cette robe te va à ravir et Soma tes vêtements te boudine moins .. ah ah ah j'ai une forme olympique. Allez en avant Guingamp, je file en tête"

Sac à dos remplis de victuailles trousse secours et reserves d'eau, ceinture gadgets en place, il sort, suivi de Kimhiko et de Soma parlant à son "autre" bonhomme dans son cerveau ^^.

<Ouverture du sas. Long couloir au sol brillant. mur blanc et doubles lignes tracées sur les murs avec fléchages distinctifs AREA SS-3>

----------------------------------------------------------------

<Salle de contrôle des caméras>
Le chef de secteur intervient auprés de l'opérateur.
"Enregistre les données vidéos pour connaitre leur parcours Monsieur Marcus voudra savoir ou ils sont allés. Je me charge de l'informer du projet au SS-6. Doublez la surveillance caméras la-bàs"

----------------------------------------------------------------

Bensen s'adressant maintenant à Soma et Kim.

"C'est bon j'ai repris le controle des caméras du couloir. J'ai craquer les lignes de code on est invisible dans ce secteur ouvert on peut parler. On file à l'annexe de l'armurerie de l'équipe de sécurité. Je l'ai vue une fois aux journées informations/sécurité .. y'a pas mal de choix mais ne t'attend pas à trouver du M61 Vulcan ou autres abérrations .. au mieux un M79 avec cartouches lacrymogènes ou lance patates adaptables. Pour toi Kim, je ne crois pas que la massue du capitaine Caverne fasse partie du lot mais qui sait ? tu trouveras peut-être ton bonheur ^^

<Longue periode de marche, on discute, on s'observe, on écoute les bruits de climatisateur. Caméras "crackées" ils approchent enfin de l'annexe bis de l'armurerie de la section sécurité>

"Soma !" Bensen désignant un boitier d'ouverture de porte en faisant signe au mythocondri-truc de défoncer la plaque de protection avec son poing ...

CRAC !! (la plaque cède)
Bensen se plug avec son pad et rentre un programme d'algorythme ... 100111010101111010100000111 ... biiiiipppp !! Cloc ! WOUUUCHHHHHH !!
La porte s'ouvre directement sur la pièce principale. Bensen qui se souvenait de la pièce se dirige vers l'armoire forte ou les armes était enfermées ... désigne l'objet au deux autres comparses :

"Euh là je sais pas faire ... un p'tit coup de main de serait pas de trop ... eh eh ! A vous l'honneur

(sourire entendu en regardant la massue et le bras de Soma qui commencait déjà à s'entourer d'une aura rougeâtre ... sans doute exité à l'idée de s'armer)

Modifié par Bensen, 27 mars 2011 - 02:02.

  • 0

Image IPB

"I was made to hit in America"
"Si tu travailles comme cette abeille ... tu t'rendras malade" (Baloo)

#118
C.S.Roy

      Mitochondriaque tri-polaire

  • messages 3 107
  • Inscrit(e) : 01 septembre 2010

  • Humeur du actuel : Aucun choisi

Réputation : 193 (Étoile montante)
-bon changement de vêtements ceux là tiennent plus lieu de tissu médical usagé-
*se change sans autre forme de procès et jette ses anciens vestiges de vêtement par terre, splortch*
-haaaa on se sent déjà mieux-
[COMMENT?! moins me boudinner? des gens sont mort bouilli par leur propre sang pour moins que cela fait gaffe! et puis je voudrait t'y voir avec cette tenue collante répugnante sentant la mort non mais]
-soma le grand retour-
[j'ai jamais été parti crétin]
-...-

*accompagne ses compagnons jusqu'à l'armurerie et prévois de démolir la porte suite à la demande de bensen*

[héhé laisser faire la torche il va y avoir une belle rouge]
-t'es sur que tu ne vas pas faire griller le contenu avec tel que je te connais, du blé cela ferait du pop-corn je dirais pas mais des armes, en plus si il y a des munitions-
*bensen leur signala que les munitions étaient dans la pièce adjacente*
[effectivement j'aurais les boules... Bon stratégie numéro deux le DAISY CUTTER]
*il commença a générer une aura verte*
-un conseil... je dirais même un avertissement, pour votre intégrité physique il est tout indiqué pour vous d'aller à l'autre bout de la pièce et de protéger vos tympans, vu que la technique utilisée génère une onde de choc via du plasma et qu'il sera fait à une intensité forte retenez-vous de respirez immédiatement après l'onde le plasma pourrais ne pas se dissiper immédiatement et se diffuser-
[enfin il dit ça, ne vous inquiétez pas je vous achèverais si il faut avec plaisir]
-...-

*les deux compères prirent sagement distance
l'aura verte se concentra entre les deux épaules et se diffusa dans les bras, un voile entoura C.S.Roy ainsi qu'un deuxième mais avec une ouverture en direction de la double-porte du coffre*

-bon l'onde sera dirigé, mais soma crois-tu qu'il y aura un retour de choc?-
[on devrait dissiper le plus gros logiquement donc LET'S GO!!]
-rhaaa de nouvelles fringue-

*entre les deux voiles se forma une substance éthérée verte puis soudain tout sembla s’effondrer vers C.S.Roy quand un énorme BANG se fit , les vitres de toute la pièce volèrent en éclats, la double-porte du coffre s'enfonça sur ses gonds avec une forte dépression en son milieu. C.S.Roy fut projeté à un mètre de sa position initiale*

-ouch ata ata ata-
[il y avait donc un retour... une chance je n'ai rien senti]
-enfoiré c'est moi au contrôle... HEY mes vêtements sont intactes génial, bon finissons le boulot maintenant que le plus gros est fait-

*se rapprocha du coffre et se mit en biais de la dépression*
-s'agit de bien viser eeeeet-
*concentra son énergie à nouveau mais sans autant la concentrer. VLAM. une des portes s'ouvrit violemment et tomba par terre les gonds ruinés tandis que l'autre trembla mais ne tomba point, il l'ouvrit manuellement*

[sésame soi défoncé! voyons voir tout ce qu'il y a ]
*traînant les deux portes sur de part et d'autre du coffre il inspecta le contenu rapidement pendant que ses compagnons se rapprochaient avec prudence, avec Soma sait-on jamais
la première porte contenait les armes de poings, la deuxième accessoires et holsters quand au coffre lui-même les armes d'épaules et autres.


[WAT?!?!? mais il y avait de collectionneur dans cette base ou quoi?
Regardez ça pour les armes de poing, un Nambu type 14, un AMT Hardballer, un luger et... un luger d'artillerie, un CZ 75 avec le chien manquant dommage, un Mauser C96, un Taurus Raging Bull sans le barillet, un colt SAA Colt Peacemaker rouillé et haha je prend le Beretta 93R et le mateba bon le reste ce sont des Glock, Browning et FN-FIVE seven]
*inspecta les deux pistolet*
[ils sont en état ceux-là de plus du 9 mm parabellum et du 357 magnum sont des calibres courants tiens étrange étrange ce barillet de six coups il est très ne laisse aucun espace, du sur mesure sans doute mais il faudra faire attention à ne pas trop tiré il risquerait de coincé]
*inspecte le reste l'armoire*
[non mais il y avait vraiment un collectionneur un Sturmgewehr 44! un FN P90 on pourrait échanger avec les munition du five-seven, un M3A1 Grease gun il devait avoir un fainéant pour les entretiens héhé, un Benelli M4... zut c'est la version civile, des carabines Colt M4 mais la moité est inutilisable, un M79 effectivement et HOHOHO cela ne rigole plus là un Neopup PAW-20 et un Auto Assault-12... mais mais il manque des parties du mécanisme de tir rhaaa, bon quoi d'autres de singulier?
un Karabiner 98k en état mais très peu pour moi par contre un SPAS 12, bon j'ai ce qu'il me faut]
-minute un truc m'énerve-

*il démonta les colt m-4 ne fonctionnant pas pour prendre les pièces en meilleur état et en assembler un neuf, installa un m-203, un garde main et un viseur point rouge*

-voilaaaaa-
[tu peux me dire à quoi cela sert?]
-à rien mais voir ces pièces gaspillées n''était insupportable, tu as as remarqué le nombre impressionnant d'armes, outre celles que tu as cité il y en a encore moultes autres-
[surtout beaucoup d’inutilisable oui, si je trouve les propriétaires je les tue non mais]
-bon allez cherchez les munitions, bensen je pense que tu sais par quel bout les tenir mais toi kimi?
Je sais que tu ne les aimes pas mais tu devrais t'équiper on ne sait jamais ce qui se dressera sur notre chemin et plus on est loin pour se défendre mieux c'est-

*il se dirigea vers la sous-pièce aux coffres à munition ayant préalablement passé des genouillère, coudières, gantelet un harnais à multiples poches, un holster d'épaules pour le Beretta 93R, un de cuisses pour le mateba et une lanière pour le spas 12.
En chemin il vit de grands conteneurs cylindriques mais n'y prêta guère attention, arrivé dans le sous-pièce il découvrit les coffres à munition de part et d'autres des murs partant du sol au plafond... ils étaient tous électroniques et les voyants lumineux rouge indiquaient qu'il étaient verrouillé*

-merde ils sont verrouillés, demandons à besen de les ouvrir-
[pas envie et puis tu manque d'imagination l'Apobiose permet de surcharger les nerfs de l'adversaire pour l'immobiliser grâce à une décharge extrêmement courte mais de forte intensité]
-oui et?-
[laisse tomber]

*Soma tendit les bras et laissa en échapper deux éclairs vert qui atteignirent les coffres et parcoururent les deux rangées en une fraction de secondes, émettant légèrement de la fumée et des grésillement les coffres s'ouvrirent*

[et voila]
-pas bête mais...-
*GROUIIIIIÎK*
[on a des réserves pas de problèmes]

*il inspecta rapidement les différents coffres avant de revenir au coffre à armes où les deux autres s'affairaient*

-bon alors il y a un peu de tout en munition par contre en calibre 12 laissé moi les Slug à ailettes, avec mon hyperkinésie qui accélère les projectiles j'obtiendrais de quoi faire peu même à un tank-
[euh...]
-oui bon un véhicule blindé léger-
[c'est mieux]
-par contre j'ai trouvé des mini-réservoir de gaz, il y a un lance-flamme dans le coin?-

*bensen lui dit que c'était pour un incinérateur de poches à vermines*

-bon je ne vois pas l'utilité de ce truc en combat mais je prend quand même les réservoir ils peuvent servir-
[du gaz, une boule de feu et FWUSH!]
-je n'aurais pas été aussi directe mais oui en gros c'est moi idée-
*s'adressant à besen*
[hey doc que contiennent ces conteneurs cylindriques? et comment les ouvrir? je pourrais bien les courts-circuiter mais j'ai trop la dalle et puis je fais puer l'azote encore plus]
*à kimi*
-Kimhiko, tu pourrais me passer de la nourriture? je suis à vide et comme tu as le sac à nourriture-

*la prêtresse lui tendis le sac, il piocha de quoi refaire ses réserves$

-mioum moi che suis équipé chauf si vous avez d'autres suggestions, des questions niveau équipement?
dommage que je n'ai pas trouvé des gilets pare-balles mais bon il ne faut pas trop demander, enfin c'était surtout pour vous moi je me régénère facilement.
quand vous êtes prêts dites le moi et l'on fera le plein de munitions, il faudra mettre les balles dans le chargeurs-

*prend un sac qui traînait dans l'armoire, met les chargeurs de m93R dedans, remarque deux distributeur automatique, s'en approche casse les vitrines à coups de crosse et entreprend consciencieusement d'en transférer le contenu des machines au sac pendant que ses compagnons faisaient leur choix*
  • 0

Image IPB

« La Belgique n'existe pas. Je le sais, j'y habite !»




"Comme univers, mon perchoir me suffit"

Image IPB


#119
KimHiko

      Prêtresse écrabouilleuse

  • messages 2 578
  • Inscrit(e) : 30 juillet 2010

  • Humeur du actuel : Aucun choisi

Réputation : 227 (Une Star !)
-(…) Bensen je pense que tu sais par quel bout les tenir mais toi kimi ? Je sais que tu ne les aimes pas mais tu devrais t'équiper on ne sait jamais ce qui se dressera sur notre chemin et plus on est loin pour se défendre, mieux c'est-

La prêtresse sur ces mots sent comme un malaise.
Sa nature pacifique allait à l’encontre des paroles de C.S.Roy.
Bien sûr, elle avait appris à manier la massue, connaissait les points d’acuponcture essentiels et maîtrisais bien d’autres armes.
Elle avait même été entraînée au combat rapproché.
Mais se servir d’une arme à feu…
Ces mêmes armes qui avaient causées tant de souffrance.
Qui avaient exterminé sa famille ainsi que les prêtresse du temple de Namae.
Celles-là même qui avaient tué il y a peu son bien aimé Kuri…
Dans un murmure inaudible Kimhiko dit :


"Je ne peux pas…"

-Kimhiko, tu pourrais me passer de la nourriture? Je suis à vide et comme tu as le sac à nourriture-

D’un geste machinal, la prêtresse tend son sac à C.S.Roy qui attrape une poignée de barres chocolatées, s’empresse de les manger et retourne à ses occupations.
Kimhiko cherche à prendre appuie contre le mur.
Elle se prends la tête entre les mains et s’écrit :


"NON, JE NE PEUX PAS !!!"

C.S.Roy se retourne vers elle avec un regard glacial.
Tout dans son allure laissé pensait que c’était Soma aux commandes.
Il marche rapidement vers elle, l’attrape par les épaules et la secoue comme un prunier :

[La chose à te demander c’est si tu veux t’en sortir vivante ! Moi je le veux ! Et ce n’est pas une petite prêtresse de pacotille qui m’en empêchera ! Les boulets, je les balance ! Alors, si tu n’es pas prête à prendre une arme, tu ferais mieux de te pendre tout de suite, parce-que de toute manière sans ça, c’est la mort qui t’attend !]

Bensen hoche la tête en signe d’approbation.
C.S.Roy lâche la prêtresse qui tombe à genoux.
Puis, il repart charger son sac de provision.

(Maître, je ne sais plus quoi faire…)
[Qu’y a t’il ?]
(Soma… il dit que je dois m’armer si je veux survivre…)
[Que te dicte ton instinct ?]
(Je crois bien…)

Kimhiko se relève en prenant appuie sur sa massue.
D’un pas incertain elle se dirige vers la pièce annexe où était rangées les munitions.
Au fond, dos à C.S.Roy il y a un placard fermé d’un simple cadenas.
Elle retire une baguette de ses cheveux, en enlève une tige de métal cachée à l’intérieur et crochète le cadenas avec maîtrise.
Elle refait son chignon, replace la baguette dans ses cheveux et ouvre le placard
A l’intérieur de ce meuble, la prêtresse trouve rangées soigneusement, des boîtes en carton étiquetées :
-Grenades lacrymogènes
-GSS
-Hornet’s Nest
-Flashbang.


"Euh… Prof’ ? Tu peux venir s’il te plaît ?"
- Oui ?
"Tu peux me trouver une arme qui va avec ça ?"
- Bouges pas.

Bensen va vers l’armoire où sont rangées les armes et reviens avec un espèce de fusil qu’il tends à Kimhiko.
La prêtresse pouvais voir sur ses lèvres une ébauche de sourire amusé.


- C’est un Thumper, un lance grenade si tu préfère. Fait attention avec ça surtout hein ce n’est pas un petit jouet en plastique.
"Je sais bien…"

C.S.Roy qui avait fini de vider les distributeurs sort de la pièce annexe accompagné de Bensen.
La prêtresse regarde l’engin et le tourne dans tout les sens.
Elle prend une grenade dans la boîte du dessus, se gratte la tête d’un air pensif et tente de la mettre dans le fusil.
Un gros « BANG »
Un nuage de fumée.


"KUF KUF KUF (bruit de toux)
Tout va bien !
C’est rien, je suis entière !"

La prêtresse sort de la pièce annexe en toussant.
Ses yeux pleuraient et elle avait le visage honteux.


"J’ai voulu voir comment ça marchait et euh…
Je ne sais pas trop ce qui s’est passé…"

Kimhiko, Bensen et C.S.Roy ont eu de la chance.
La grenade que la prêtresse avait utilisée pour son test était une grenade lacrymogène…
Un autre modèle les aurait sans doute réduit en bouilli.
L'onde de choc n'avait pas fait exploser les munitions entreposées mais avait désactivée tout les système électrique de sécurité alentour.
Des portes s'ouvrirent d'elles-même un peu partout.

Les yeux toujours larmoyants la prêtresse dit à ses compagnons :

"Si vous tenez toujours à ce que je prenne ce truc il va falloir que vous m’expliquiez comment je dois m’en servir…"

KUF KUF KUF
  • 0

Image IPB

Pensez à lire ceci : Le Règlement,Avertissements et sanctions. Merci !


#120
Bensen

      El Profesor

  • messages 433
  • Inscrit(e) : 01 février 2011

  • Humeur du actuel : Rayonnante

Réputation : 60 (Se fait un nom)
<Aussitôt aprés l'explosion Bensen se precipita vers une prise réseau incrustée dans un mur et s'empressa d'y pluger son perso-pad>

"Atatatatatattaaaa vite vite vite !!! Fluuuuuttteeeee"

<tactactactactactactact rapidement il tapote ... lignes de codes ... lignes de commandes ... réseau INPUT ... CLIC !. Se déplug et sourit d'un air ravit>

"PO pipo pipo popi po ! on l'a échappé belle. J'ai réussi à déconnecter les senseurs de fumées. S'ils avaient détectés les fumées lacrymogènes ILS nous auraient détectés dans cette salle et bye-bye la couverture"

<Se dirige maintenant avec assurance vers Kimhiko encore toute perdue de sa boulette>

"OK désolé, my mistake. Je n'aurais pas du te laisser ça comme ça sans t'expliquer au moins l'usage de la bête. Tu nous à au moins redébloqué le sportes ^^. Bon alors ce que tu as là est un M79, un lance-grenades ... un lance-patates, un tire-boulette si tu preferes. Ca peut tirer de tout mais au vue de la situation et surtout de la distance d'engagement, je te rassure tout de suite, tu n'auras pas à utiliser quelques munitions létales que ce soient. Placée entre nous deux tu assureras notre soutien arrière. Je vais te confier la charge de neutraliser tout ce qui arrivera à ta portée de tir utile ... on va compter 20-30 mètres pas plus"

<Kimhiko ... le regard vide ... intègre quelques bribes de mots au charabia énonçé par Bensen>

"M79 ... patates ... munitions ... 30 mètres ... Qu'est-ce que ?? Gné ??"

<Soma tendi l'oreille, le regard aussi vif qu'un Epagneul breton>

"Des patates ? c'est l'heure de manger ???"

<Bensen s'approchant de Kimhiko, et lui tendant sa massue. Il prend le M79 et lui enjoint de l'imiter>

"Prends ça et épaule comme si c'était ton lanceur"

<Kimhiko empoigne fermement sa massue et sans crainte la plaque contre son épaule tout en imitant Bensen. Esquisse un sourire de satisfaction. et lance>

"OUi mais ce n'est pas pareille, JE NE VEUX PAS TUER DES GENS !!!" NON !!

"OK pa ni problem ... je vais te confier le soutien arrière ça veut dire que tu interviendra s'il le faut sur des cibles et des mobiles que nous ne pourront pas traiter Soma et moi. Pour cela tu seras équipée de grenades-filet et de flash-ball. On oublie les lacrymo car on sera aussi embeté qu'eux si le couloir venait à être envahis par les gazs. En plus les masques empecheront vos incantations d'être audibles en cas de ...."

<Regle le dispositif de visée du M79 et le tend à Kimhiko>
"Bon prend ça comme ta massue à l'instant. Tu fais basculer le canon en appuyant avec ton pouce sur le loquet sur le dessus. Une fois ouvert tu introduis la grenade en la saississant par le cul (et oui on dit comme ça) et tu refermes avec ta main libre ou en imprimant au lanceur un vif mouvement sec vers le haut (façon Terminator II dans le batiment de Cyberdine). Apres ça c'est pret à tirer. Quand tu viseras en tir tendu un bonhomme ou un mechant quitasueños ... fais le rentrer dans ce rectangle. Une fois que la cible remplira l'espace de ce rectangle tu appliques une forte pression sur ton index et là normalement tu ressentiras la même chose que toutes à l'heure ... ça va squizzer !!"

<Kimhiko>
"Rectangle ... remplir ... squizzer"

<Bensen>
"Donc pour faire simple les grenades ROUGE formeront un filet avec des boules autour qui arreterait 4 footballeurs américain en rut et en pleine charge ... les BLEU sont des flash-ball de 40mm de diametre. Ca t'assome n'importe quoi à 20m si tu vise la cage thoracique ou la tête. ALORS si tu te sers de ça ... tu pourras toujours leur placer une aiguille magique pour les immobiliser une fois qu'ils seront par terre"

<Se gratte la nuque>

"T'a l'air de savoir faire ça donc autant profiter de ton savoir faire et ne pas t'en demander plus que necessaire. Ca te convient comme ça ? Si tu veux prendre une matraque electrique comme celle que j'ai donné à Onee-chan. Ca assomme bien aussi si tu tape bien fort en appuyant sur ce bouton rouge. Mais bon nous n'avons pas non plus de munitions ni de prise de courant à portée de main alors économisons un minimum"

<Se dirige à son tour vers l'armoire et s'équipe légerement. Un dispositif de vision nocturne et infrarouge d'age prehistorique ... Son Sig, un MP7, des chargeurs, grenades aveuglantes, assourdissantes et offensives, des munitions perforantes et Oh trouvaille deux pains de C4 ... Se retourne vers Soma et tout en graillant ses chargeurs>

"Pas de blagues hein Soma, rien de lourd qui pourrait nous blesser en retour, pas de munitions explosives ni de trop puissant. Prends des perforantes pour passer au travers de murs. Ici tout est en placoplatres ou en acier leger ... on economisera comme ça"

<S'adressant aux deux maintenant, tout en se dirigeant vers la sortie>
"Kim OK ? Soma ? On peut y aller ... On file tout droit, Kim je te confie les lunettes infrarouge pour que tu ne sois pas en reste. Soma tu y vois dans la nuit je crois ? non ? En avant-VANT, Azimut-MUT ... C'est parti et on garde l'oeil ouvert ... espacement 4 metres entre chaques"

<Clin d'oeil vers Kim>

"Ca va aller tu t'en sors déjà trés bien .. et puis mes deux ans passés à crapahuter pendant cette satanée guerre en Asie vont peut-être servir à quelque chose d'utile maintenant."

<Bensen mets en route son dispositif oculaire et brouilleur intégré à ses lunettes et s'apprete à prendre la tête du groupe>

"Des questions ? On peut y aller ?"

Modifié par Bensen, 28 mars 2011 - 13:48.

  • 0

Image IPB

"I was made to hit in America"
"Si tu travailles comme cette abeille ... tu t'rendras malade" (Baloo)





0 utilisateur(s) dans ce forum

0 membre(s), 0 invité(s), 0 utilisateur(s) anonyme(s)

Community Forum Software by IP.Board
Licence accordée à : AnimeServ.NET
Design & Code by Bad.Y o/
© 2013 AnimeServ